Transcript: Human XM_017016181.1

PREDICTED: Homo sapiens von Willebrand factor A domain containing 2 (VWA2), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VWA2 (340706)
Length:
1396
CDS:
46..1293

Additional Resources:

NCBI RefSeq record:
XM_017016181.1
NBCI Gene record:
VWA2 (340706)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430415 AGTCTTCGTGAAGCGGTTTGT pLKO_005 1168 CDS 100% 4.950 6.930 N VWA2 n/a
2 TRCN0000423366 AGACGGAACTTGCTCTGAAAT pLKO_005 461 CDS 100% 13.200 9.240 N VWA2 n/a
3 TRCN0000056195 GTGGACATCATGTTTCTGTTA pLKO.1 223 CDS 100% 4.950 3.465 N VWA2 n/a
4 TRCN0000056197 CCATGTAAGCAAAGAAACCAT pLKO.1 156 CDS 100% 3.000 2.100 N VWA2 n/a
5 TRCN0000056193 GCAAGAATCAAGAGGATGGTT pLKO.1 421 CDS 100% 3.000 2.100 N VWA2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016181.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13603 pDONR223 100% 13.5% 9.9% None 1_946del;1245_1246ins964 n/a
2 ccsbBroad304_13603 pLX_304 0% 13.5% 9.9% V5 1_946del;1245_1246ins964 n/a
3 TRCN0000491517 TTGCGCGGGTTATACTACTGTGAG pLX_317 26.9% 13.5% 9.9% V5 1_946del;1245_1246ins964 n/a
Download CSV