Transcript: Human XM_017016189.1

PREDICTED: Homo sapiens insulin degrading enzyme (IDE), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
IDE (3416)
Length:
5249
CDS:
116..3052

Additional Resources:

NCBI RefSeq record:
XM_017016189.1
NBCI Gene record:
IDE (3416)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000255818 CTTGACCGAGGAAGGATTATT pLKO_005 1126 CDS 100% 15.000 21.000 N IDE n/a
2 TRCN0000255815 CTTACTATTCATCCAACTTAA pLKO_005 732 CDS 100% 13.200 18.480 N IDE n/a
3 TRCN0000000245 CCTGACTTAATAGAGATGGTT pLKO.1 1373 CDS 100% 3.000 4.200 N IDE n/a
4 TRCN0000255816 ATAACTGTGGCATCGAGATAT pLKO_005 2352 CDS 100% 13.200 9.240 N IDE n/a
5 TRCN0000000247 CCTGAAGACAAGCGAGAATAT pLKO.1 164 CDS 100% 13.200 9.240 N IDE n/a
6 TRCN0000255819 TAGTGGAGAGCATACCAATTA pLKO_005 418 CDS 100% 13.200 9.240 N IDE n/a
7 TRCN0000255817 TAGTTTCTGATTCACTATTAG pLKO_005 3135 3UTR 100% 13.200 9.240 N IDE n/a
8 TRCN0000000248 ACTTGACTAATCTGGTGGTAA pLKO.1 789 CDS 100% 4.950 3.465 N IDE n/a
9 TRCN0000000244 ATGGGAAAGTGCAAGTGGATG pLKO.1 3066 3UTR 100% 4.050 2.835 N IDE n/a
10 TRCN0000000246 CCTGGTCATTATCTTGGTCAT pLKO.1 980 CDS 100% 4.050 2.835 N IDE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016189.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00816 pDONR223 100% 95.9% 95.9% None 0_1ins123 n/a
2 ccsbBroad304_00816 pLX_304 0% 95.9% 95.9% V5 0_1ins123 n/a
3 TRCN0000471357 CATCCTTATAACGCTGTCCATTCA pLX_317 14.9% 95.9% 95.9% V5 0_1ins123 n/a
Download CSV