Transcript: Human XM_017016206.1

PREDICTED: Homo sapiens coiled-coil domain containing 172 (CCDC172), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC172 (374355)
Length:
1617
CDS:
170..946

Additional Resources:

NCBI RefSeq record:
XM_017016206.1
NBCI Gene record:
CCDC172 (374355)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000140513 GCCGTTTGATGCGAGAAGTAA pLKO.1 231 CDS 100% 5.625 7.875 N CCDC172 n/a
2 TRCN0000145426 GAAATAACCAGATGTCGTGAA pLKO.1 257 CDS 100% 4.050 5.670 N CCDC172 n/a
3 TRCN0000139993 GCGAGAAGTAAGGTCGGAAAT pLKO.1 241 CDS 100% 10.800 8.640 N CCDC172 n/a
4 TRCN0000143452 GAGTTGACATTGGCACAGAAA pLKO.1 905 CDS 100% 4.950 3.960 N CCDC172 n/a
5 TRCN0000143534 GCTGGAATCTAAGGTTCAACA pLKO.1 322 CDS 100% 4.950 3.960 N CCDC172 n/a
6 TRCN0000143922 CGAGAAGTAAGGTCGGAAATA pLKO.1 242 CDS 100% 13.200 9.240 N CCDC172 n/a
7 TRCN0000121925 CTTCAAACCTTTGAGGCTATA pLKO.1 440 CDS 100% 10.800 7.560 N CCDC172 n/a
8 TRCN0000145075 CACAGAAAGATCTTCAGGAAA pLKO.1 918 CDS 100% 4.950 3.465 N CCDC172 n/a
9 TRCN0000121570 CCAAATATCTAGAGGCAGAAA pLKO.1 756 CDS 100% 4.950 3.465 N CCDC172 n/a
10 TRCN0000121954 CCATAGGAATATGCTTCTTCA pLKO.1 424 CDS 100% 4.950 3.465 N CCDC172 n/a
11 TRCN0000144813 GAAGATGACATGGAAAGTGTT pLKO.1 851 CDS 100% 4.950 3.465 N CCDC172 n/a
12 TRCN0000139834 CATCATCTTCACCGAGCATCA pLKO.1 196 CDS 100% 4.050 2.835 N CCDC172 n/a
13 TRCN0000145103 GAAAGATCTTCAGGAAAGCAA pLKO.1 922 CDS 100% 3.000 2.100 N CCDC172 n/a
14 TRCN0000143802 GAGGAGCTGAATGAAGAGAAA pLKO.1 296 CDS 100% 4.950 2.970 N CCDC172 n/a
15 TRCN0000145172 GAAACAAATGATAGAGGAGGA pLKO.1 463 CDS 100% 2.160 1.080 Y CCDC172 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016206.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05532 pDONR223 100% 100% 100% None n/a
2 ccsbBroad304_05532 pLX_304 0% 100% 100% V5 n/a
3 TRCN0000468436 TTCCGCAGCAACAAATAGGTTTTG pLX_317 63.9% 100% 100% V5 n/a
Download CSV