Transcript: Human XM_017016429.1

PREDICTED: Homo sapiens KIAA1217 (KIAA1217), transcript variant X26, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
KIAA1217 (56243)
Length:
6003
CDS:
859..4653

Additional Resources:

NCBI RefSeq record:
XM_017016429.1
NBCI Gene record:
KIAA1217 (56243)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000434223 GATCCTGCACATGCGTTTAAT pLKO_005 1411 CDS 100% 15.000 21.000 N KIAA1217 n/a
2 TRCN0000438701 ATCGCCCAGTGTCGCCATTTA pLKO_005 1302 CDS 100% 13.200 18.480 N KIAA1217 n/a
3 TRCN0000122815 GCTAAGGCAAGCAGTGAAGAT pLKO.1 3859 CDS 100% 4.950 6.930 N KIAA1217 n/a
4 TRCN0000429409 TGTATCGTTTGAGGCTTAATG pLKO_005 4747 3UTR 100% 13.200 10.560 N KIAA1217 n/a
5 TRCN0000122253 CAGAGCTTGTTCATTGAAGAA pLKO.1 3454 CDS 100% 4.950 3.960 N KIAA1217 n/a
6 TRCN0000143760 CCTCTAATGGAGAAGCAAGTT pLKO.1 2233 CDS 100% 4.950 3.960 N KIAA1217 n/a
7 TRCN0000145223 GAAAGGAGAATTTCCAACCTT pLKO.1 2922 CDS 100% 3.000 2.100 N KIAA1217 n/a
8 TRCN0000142602 GCACAGTACATGGCTATGGAA pLKO.1 3121 CDS 100% 3.000 2.100 N KIAA1217 n/a
9 TRCN0000144062 CGGAAATGCATATGGAACAAT pLKO.1 1943 CDS 100% 0.000 0.000 N KIAA1217 n/a
10 TRCN0000143347 GATGAAGACATGAGTGGCAAA pLKO.1 1744 CDS 100% 4.050 2.430 N KIAA1217 n/a
11 TRCN0000190517 GAGGAGGAAGAAGAAGAAGAA pLKO.1 3985 CDS 100% 4.950 2.475 Y G430095P16Rik n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016429.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12297 pDONR223 100% 60.9% 60.6% None (many diffs) n/a
2 ccsbBroad304_12297 pLX_304 0% 60.9% 60.6% V5 (many diffs) n/a
Download CSV