Transcript: Human XM_017016432.2

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C12 (DNAJC12), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC12 (56521)
Length:
1145
CDS:
344..694

Additional Resources:

NCBI RefSeq record:
XM_017016432.2
NBCI Gene record:
DNAJC12 (56521)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016432.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022318 TGGGATGTGATGAACTATCTT pLKO.1 232 5UTR 100% 5.625 4.500 N DNAJC12 n/a
2 TRCN0000273886 TGGGATGTGATGAACTATCTT pLKO_005 232 5UTR 100% 5.625 4.500 N DNAJC12 n/a
3 TRCN0000273829 GAAGTTCAGAAACTATGAAAT pLKO_005 670 CDS 100% 13.200 9.240 N DNAJC12 n/a
4 TRCN0000022317 GAAGAATCTGACAAGACTCAT pLKO.1 437 CDS 100% 4.950 3.465 N DNAJC12 n/a
5 TRCN0000022315 GCAAAGGAGATTCTGACCAAT pLKO.1 281 5UTR 100% 4.950 3.465 N DNAJC12 n/a
6 TRCN0000273831 GCAAAGGAGATTCTGACCAAT pLKO_005 281 5UTR 100% 4.950 3.465 N DNAJC12 n/a
7 TRCN0000022314 GCAGTCTTTGTTTATGTCTTA pLKO.1 752 3UTR 100% 4.950 3.465 N DNAJC12 n/a
8 TRCN0000022316 GCTGGCTTCAACCGCAGAGAA pLKO.1 514 CDS 100% 1.650 1.155 N DNAJC12 n/a
9 TRCN0000273828 GCTGGCTTCAACCGCAGAGAA pLKO_005 514 CDS 100% 1.650 1.155 N DNAJC12 n/a
10 TRCN0000273887 TGTGAATTGCTGAGTACTAAT pLKO_005 797 3UTR 100% 13.200 7.920 N DNAJC12 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016432.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03725 pDONR223 100% 58.5% 58.5% None 0_1ins246 n/a
2 TRCN0000474287 TTCAAGCATATGGTAGAACCTCGT pLX_317 75.5% 58.5% 58.5% V5 0_1ins246 n/a
Download CSV