Transcript: Human XM_017016469.2

PREDICTED: Homo sapiens protein tyrosine phosphatase receptor type E (PTPRE), transcript variant X9, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPRE (5791)
Length:
1651
CDS:
182..1630

Additional Resources:

NCBI RefSeq record:
XM_017016469.2
NBCI Gene record:
PTPRE (5791)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000315198 CTGCGACCATCGTCATGTTAA pLKO_005 921 CDS 100% 13.200 9.240 N PTPRE n/a
2 TRCN0000002896 TGGACACATACAAGGAACTTT pLKO.1 673 CDS 100% 5.625 3.938 N PTPRE n/a
3 TRCN0000002895 ACGTTCATCTACCAAGCCTTA pLKO.1 1394 CDS 100% 4.050 2.835 N PTPRE n/a
4 TRCN0000010744 CAAGAAGATGCCCAACGGAAT pLKO.1 490 CDS 100% 4.050 2.835 N PTPRE n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016469.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06817 pDONR223 100% 64% 64.1% None (many diffs) n/a
2 ccsbBroad304_06817 pLX_304 0% 64% 64.1% V5 (many diffs) n/a
3 TRCN0000478447 GGGGGCCTAAGAAGTTATTTTTAG pLX_317 13.3% 64% 64.1% V5 (many diffs) n/a
Download CSV