Transcript: Human XM_017016536.2

PREDICTED: Homo sapiens DnaJ heat shock protein family (Hsp40) member C1 (DNAJC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DNAJC1 (64215)
Length:
1527
CDS:
330..1415

Additional Resources:

NCBI RefSeq record:
XM_017016536.2
NBCI Gene record:
DNAJC1 (64215)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016536.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000022305 GCAGCAAGAGTGTGGATGTAT pLKO.1 913 CDS 100% 5.625 3.938 N DNAJC1 n/a
2 TRCN0000297811 GCAGCAAGAGTGTGGATGTAT pLKO_005 913 CDS 100% 5.625 3.938 N DNAJC1 n/a
3 TRCN0000022308 GCATATCGTAAGCTTTCACTA pLKO.1 579 CDS 100% 4.950 3.465 N DNAJC1 n/a
4 TRCN0000280286 GCATATCGTAAGCTTTCACTA pLKO_005 579 CDS 100% 4.950 3.465 N DNAJC1 n/a
5 TRCN0000022304 GCTGGCATTACTCTTGTTCAT pLKO.1 788 CDS 100% 4.950 3.465 N DNAJC1 n/a
6 TRCN0000022307 GCAGCTCAACTTCTACCAGTT pLKO.1 515 CDS 100% 4.050 2.835 N DNAJC1 n/a
7 TRCN0000280333 GCAGCTCAACTTCTACCAGTT pLKO_005 515 CDS 100% 4.050 2.835 N DNAJC1 n/a
8 TRCN0000008540 CCAGACAAGAATAAAGATGAA pLKO.1 609 CDS 100% 4.950 2.970 N Dnajc1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016536.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12460 pDONR223 100% 23.9% 21.1% None (many diffs) n/a
2 ccsbBroad304_12460 pLX_304 0% 23.9% 21.1% V5 (many diffs) n/a
3 TRCN0000465875 TCTCCACTCTCTTGAGCCTGCTCG pLX_317 14.7% 23.9% 21.1% V5 (many diffs) n/a
Download CSV