Transcript: Human XM_017016607.1

PREDICTED: Homo sapiens NUT family member 2A (NUTM2A), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NUTM2A (728118)
Length:
5334
CDS:
3228..5117

Additional Resources:

NCBI RefSeq record:
XM_017016607.1
NBCI Gene record:
NUTM2A (728118)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000269667 GTGAGTCAGAAGGACAATTTA pLKO_005 3265 CDS 100% 15.000 7.500 Y NUTM2A n/a
2 TRCN0000269714 TATGTTCCAGGAACCTGTTTA pLKO_005 3442 CDS 100% 13.200 6.600 Y NUTM2A n/a
3 TRCN0000269666 TGCTCCTGTGGTGCCTGTTAT pLKO_005 3980 CDS 100% 13.200 6.600 Y NUTM2A n/a
4 TRCN0000135086 CAGGAGTGTCTATGAGAACTT pLKO.1 4205 CDS 100% 4.950 2.475 Y NUTM2D n/a
5 TRCN0000136973 CCAACGTCTTTGTCCAGATGA pLKO.1 3829 CDS 100% 4.950 2.475 Y NUTM2D n/a
6 TRCN0000136669 GAGCAACTTTGACCGGATGAT pLKO.1 4397 CDS 100% 4.950 2.475 Y NUTM2D n/a
7 TRCN0000135952 GAGGAGATGCAGATTCAGAAA pLKO.1 4461 CDS 100% 4.950 2.475 Y NUTM2D n/a
8 TRCN0000135560 GATGGCTTCAAATGGAGCATA pLKO.1 3593 CDS 100% 4.950 2.475 Y NUTM2D n/a
9 TRCN0000137405 GCTACACTGACAAGCTGTGTT pLKO.1 4918 CDS 100% 4.950 2.475 Y NUTM2D n/a
10 TRCN0000137007 CTGTTTCAGTTGGACTCAGGA pLKO.1 3477 CDS 100% 2.640 1.320 Y NUTM2D n/a
11 TRCN0000136789 CCCAGATCCACAGATGGATTT pLKO.1 5006 CDS 100% 1.080 0.540 Y NUTM2D n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016607.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12074 pDONR223 100% 53.4% 50.5% None (many diffs) n/a
2 ccsbBroad304_12074 pLX_304 0% 53.4% 50.5% V5 (many diffs) n/a
3 TRCN0000478809 TTCCCTACAATATTCTCACAAGGC pLX_317 12.3% 53.4% 50.5% V5 (many diffs) n/a
Download CSV