Transcript: Human XM_017016672.1

PREDICTED: Homo sapiens MINDY lysine 48 deubiquitinase 3 (MINDY3), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MINDY3 (80013)
Length:
2528
CDS:
809..1705

Additional Resources:

NCBI RefSeq record:
XM_017016672.1
NBCI Gene record:
MINDY3 (80013)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000310273 TGAATGATTCCGGCTTGTAAT pLKO_005 2091 3UTR 100% 13.200 18.480 N MINDY3 n/a
2 TRCN0000264565 GAGCGATTTCATGCATTAATT pLKO_005 714 5UTR 100% 15.000 10.500 N Mindy3 n/a
3 TRCN0000056108 CCCTTGATAGATCCTGTATAT pLKO.1 986 CDS 100% 13.200 9.240 N MINDY3 n/a
4 TRCN0000289714 CCCTTGATAGATCCTGTATAT pLKO_005 986 CDS 100% 13.200 9.240 N MINDY3 n/a
5 TRCN0000056112 CTGAGGAAACTGCTAGTATTT pLKO.1 622 5UTR 100% 13.200 9.240 N MINDY3 n/a
6 TRCN0000307133 CTGAGGAAACTGCTAGTATTT pLKO_005 622 5UTR 100% 13.200 9.240 N MINDY3 n/a
7 TRCN0000056109 GCCAAGGATATGGCTTTAGTT pLKO.1 1244 CDS 100% 5.625 3.938 N MINDY3 n/a
8 TRCN0000056111 CAATGGATTGAAGCAGTCAAA pLKO.1 1522 CDS 100% 4.950 3.465 N MINDY3 n/a
9 TRCN0000056110 GTTCAGAAGTTTACCAGAATT pLKO.1 838 CDS 100% 0.000 0.000 N MINDY3 n/a
10 TRCN0000289715 GTTCAGAAGTTTACCAGAATT pLKO_005 838 CDS 100% 0.000 0.000 N MINDY3 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016672.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04165 pDONR223 100% 66.5% 66% None (many diffs) n/a
2 ccsbBroad304_04165 pLX_304 0% 66.5% 66% V5 (many diffs) n/a
Download CSV