Transcript: Human XM_017016934.1

PREDICTED: Homo sapiens zinc finger AN1-type containing 4 (ZFAND4), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFAND4 (93550)
Length:
4335
CDS:
265..2466

Additional Resources:

NCBI RefSeq record:
XM_017016934.1
NBCI Gene record:
ZFAND4 (93550)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017016934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000007776 GCCATCTAGTAATGGGAACAT pLKO.1 1404 CDS 100% 4.950 6.930 N ZFAND4 n/a
2 TRCN0000007775 GCGGACCTATAAATACTAGAA pLKO.1 569 CDS 100% 4.950 6.930 N ZFAND4 n/a
3 TRCN0000007773 CGGACATGAATCCATTCTATA pLKO.1 3077 3UTR 100% 13.200 10.560 N ZFAND4 n/a
4 TRCN0000007774 CCGGGAATTAAGTCCTCACAA pLKO.1 1665 CDS 100% 4.950 3.960 N ZFAND4 n/a
5 TRCN0000007777 GCCTGTTGGTTGTGTAAATAA pLKO.1 1959 CDS 100% 15.000 10.500 N ZFAND4 n/a
6 TRCN0000432629 ACTTGCTTTCAAGGTGTTAAA pLKO_005 1852 CDS 100% 13.200 9.240 N ZFAND4 n/a
7 TRCN0000421670 TCCTACAGACGATCCACTTAG pLKO_005 594 CDS 100% 10.800 7.560 N ZFAND4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017016934.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12996 pDONR223 100% 88.9% 88.8% None (many diffs) n/a
2 ccsbBroad304_12996 pLX_304 0% 88.9% 88.8% V5 (many diffs) n/a
3 TRCN0000479053 ACGTTTCACCATTGGGCGGATGGT pLX_317 19.6% 88.9% 88.8% V5 (many diffs) n/a
Download CSV