Transcript: Human XM_017017114.2

PREDICTED: Homo sapiens CUGBP Elav-like family member 1 (CELF1), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CELF1 (10658)
Length:
4447
CDS:
136..1665

Additional Resources:

NCBI RefSeq record:
XM_017017114.2
NBCI Gene record:
CELF1 (10658)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017114.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000233074 TACTCGGGTATCCAGCAATAT pLKO_005 1291 CDS 100% 13.200 18.480 N CELF1 n/a
2 TRCN0000221656 CGAGTCATGTTCTCTTCGTTT pLKO.1 589 CDS 100% 4.950 3.960 N CELF1 n/a
3 TRCN0000233072 AGCTGTTTATTGGTATGATTT pLKO_005 542 CDS 100% 13.200 9.240 N CELF1 n/a
4 TRCN0000233075 ATTGGCATGAAGCGGCTTAAA pLKO_005 1603 CDS 100% 13.200 9.240 N CELF1 n/a
5 TRCN0000221657 CCTAGCTCTAGCAGCAGTAAT pLKO.1 1105 CDS 100% 13.200 9.240 N CELF1 n/a
6 TRCN0000233073 GATTGAAGAATGCCGGATATT pLKO_005 615 CDS 100% 13.200 9.240 N CELF1 n/a
7 TRCN0000098510 CGTCAAGTACATCGTCCAAAT pLKO.1 1751 3UTR 100% 10.800 7.560 N Celf1 n/a
8 TRCN0000233076 CGTCAAGTACATCGTCCAAAT pLKO_005 1751 3UTR 100% 10.800 7.560 N CELF1 n/a
9 TRCN0000326898 CGTCAAGTACATCGTCCAAAT pLKO_005 1751 3UTR 100% 10.800 7.560 N Celf1 n/a
10 TRCN0000221654 CGGCTTAAAGTGCAGCTCAAA pLKO.1 1615 CDS 100% 4.950 3.465 N CELF1 n/a
11 TRCN0000221655 GCTGCATTAGAAGCTCAGAAT pLKO.1 427 CDS 100% 4.950 3.465 N CELF1 n/a
12 TRCN0000221658 CTTGATGCTATCAAGATGTTT pLKO.1 253 CDS 100% 0.563 0.394 N CELF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017114.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.