Transcript: Human XM_017017157.1

PREDICTED: Homo sapiens solute carrier organic anion transporter family member 2B1 (SLCO2B1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLCO2B1 (11309)
Length:
3963
CDS:
8..2143

Additional Resources:

NCBI RefSeq record:
XM_017017157.1
NBCI Gene record:
SLCO2B1 (11309)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000419252 ATGATCTCCGGCTACCTAAAG pLKO_005 203 CDS 100% 10.800 15.120 N SLCO2B1 n/a
2 TRCN0000432319 TGGTATCAGCCTGACCATAAA pLKO_005 796 CDS 100% 13.200 10.560 N SLCO2B1 n/a
3 TRCN0000426757 GATTGTGTTTGTGAGCTATTT pLKO_005 316 CDS 100% 13.200 9.240 N SLCO2B1 n/a
4 TRCN0000005156 GCGCCTTTATGTGGACATTAA pLKO.1 760 CDS 100% 13.200 9.240 N SLCO2B1 n/a
5 TRCN0000005157 CCAAGGAAATGCCCAAGGAAA pLKO.1 906 CDS 100% 4.950 3.465 N SLCO2B1 n/a
6 TRCN0000005158 CCTGACTGTGATCCAGTTCAT pLKO.1 1063 CDS 100% 4.950 3.465 N SLCO2B1 n/a
7 TRCN0000010927 GCTCATCCTAAGAGGAGTGAA pLKO.1 1765 CDS 100% 4.950 3.465 N SLCO2B1 n/a
8 TRCN0000005155 GCCTTTAAGAAGTGTCCCTTT pLKO.1 2658 3UTR 100% 4.050 2.835 N SLCO2B1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017157.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07795 pDONR223 100% 99.1% 99.1% None (many diffs) n/a
2 ccsbBroad304_07795 pLX_304 0% 99.1% 99.1% V5 (many diffs) n/a
Download CSV