Transcript: Human XM_017017175.1

PREDICTED: Homo sapiens solute carrier family 36 member 4 (SLC36A4), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SLC36A4 (120103)
Length:
2832
CDS:
379..1575

Additional Resources:

NCBI RefSeq record:
XM_017017175.1
NBCI Gene record:
SLC36A4 (120103)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000043983 CCTCGTTTAGACATTGTGATT pLKO.1 1288 CDS 100% 4.950 6.930 N SLC36A4 n/a
2 TRCN0000043985 CCTGGAGAGTAAAGTGTTTAT pLKO.1 615 CDS 100% 13.200 9.240 N SLC36A4 n/a
3 TRCN0000043986 GATGAAATCAAAGGCAGCATA pLKO.1 1051 CDS 100% 4.950 3.465 N SLC36A4 n/a
4 TRCN0000043987 CCAGTATGTTGTCAGGAACAT pLKO.1 813 CDS 100% 0.495 0.347 N SLC36A4 n/a
5 TRCN0000043984 CCTTGATAAATGAGCAGAATT pLKO.1 225 5UTR 100% 0.000 0.000 N SLC36A4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017175.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09464 pDONR223 100% 78.7% 78.3% None (many diffs) n/a
2 ccsbBroad304_09464 pLX_304 0% 78.7% 78.3% V5 (many diffs) n/a
3 TRCN0000467203 ACGATTAAAGCTCTTAACATGTAT pLX_317 17.3% 78.7% 78.3% V5 (many diffs) n/a
Download CSV