Transcript: Human XM_017017232.2

PREDICTED: Homo sapiens X-ray radiation resistance associated 1 (XRRA1), transcript variant X28, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
XRRA1 (143570)
Length:
4363
CDS:
836..1858

Additional Resources:

NCBI RefSeq record:
XM_017017232.2
NBCI Gene record:
XRRA1 (143570)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000246333 GGAACTGGATCTCGCATTTAA pLKO_005 565 5UTR 100% 15.000 21.000 N XRRA1 n/a
2 TRCN0000246334 CAGATGAGCAACTGGATTATA pLKO_005 1059 CDS 100% 15.000 12.000 N XRRA1 n/a
3 TRCN0000257496 TCAGATCTGTGCACCATTAAT pLKO_005 419 5UTR 100% 15.000 10.500 N XRRA1 n/a
4 TRCN0000257505 AGACAAGACTCTGACTATAAA pLKO_005 2832 3UTR 100% 15.000 9.000 N XRRA1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017232.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_13216 pDONR223 100% 55.8% 54.4% None (many diffs) n/a
2 ccsbBroad304_13216 pLX_304 0% 55.8% 54.4% V5 (many diffs) n/a
3 TRCN0000468202 AGATGAGCGTCCCATCGAAGAGAA pLX_317 18.9% 55.8% 54.4% V5 (many diffs) n/a
Download CSV