Transcript: Human XM_017017239.2

PREDICTED: Homo sapiens CWF19 like cell cycle control factor 2 (CWF19L2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CWF19L2 (143884)
Length:
2581
CDS:
771..2027

Additional Resources:

NCBI RefSeq record:
XM_017017239.2
NBCI Gene record:
CWF19L2 (143884)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000422940 TGCAATAGGTGTTAAGGTTTA pLKO_005 1412 CDS 100% 10.800 15.120 N CWF19L2 n/a
2 TRCN0000419032 GATGATAATCTAAGCCTAAAT pLKO_005 1122 CDS 100% 13.200 9.240 N CWF19L2 n/a
3 TRCN0000421355 GGTAGAAGATGGTGGATTAAG pLKO_005 667 5UTR 100% 13.200 9.240 N CWF19L2 n/a
4 TRCN0000134054 CCATTGCATCTAATGAAGCAA pLKO.1 2079 3UTR 100% 3.000 2.100 N CWF19L2 n/a
5 TRCN0000135387 GAACAGTCCAAACTGATGGAA pLKO.1 560 5UTR 100% 3.000 2.100 N CWF19L2 n/a
6 TRCN0000135495 GTGGTGGAAACCATATGACTT pLKO.1 1985 CDS 100% 0.000 0.000 N CWF19L2 n/a
7 TRCN0000134074 GAGTGTTGATGAGAAGAACAA pLKO.1 806 CDS 100% 4.950 2.970 N CWF19L2 n/a
8 TRCN0000136003 GCAGCTACTTTGTTGGATGAA pLKO.1 1503 CDS 100% 4.950 2.970 N CWF19L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017239.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.