Transcript: Human XM_017017406.1

PREDICTED: Homo sapiens Fli-1 proto-oncogene, ETS transcription factor (FLI1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FLI1 (2313)
Length:
3069
CDS:
381..1640

Additional Resources:

NCBI RefSeq record:
XM_017017406.1
NBCI Gene record:
FLI1 (2313)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000235383 AGTTCACTGCTGGCCTATAAT pLKO_005 870 CDS 100% 15.000 21.000 N FLI1 n/a
2 TRCN0000235386 CTTTGGAGCCGCATCACAATA pLKO_005 1526 CDS 100% 13.200 18.480 N FLI1 n/a
3 TRCN0000005322 CGTCATGTTCTGGTTTGAGAT pLKO.1 2039 3UTR 100% 4.950 6.930 N FLI1 n/a
4 TRCN0000005324 GCACAAACGATCAGTAAGAAT pLKO.1 1020 CDS 100% 5.625 4.500 N FLI1 n/a
5 TRCN0000235385 CACAAACGATCAGTAAGAATA pLKO_005 1021 CDS 100% 13.200 9.240 N FLI1 n/a
6 TRCN0000235384 TATCGAATCAATCGCTGTTAT pLKO_005 2592 3UTR 100% 13.200 9.240 N FLI1 n/a
7 TRCN0000235382 TCAACGTCAAGCGGGAGTATG pLKO_005 472 CDS 100% 10.800 7.560 N FLI1 n/a
8 TRCN0000042673 CGGGAGTATGACCACATGAAT pLKO.1 483 CDS 100% 5.625 3.938 N Fli1 n/a
9 TRCN0000005323 CCCATGAACTACAACAGCTAT pLKO.1 576 CDS 100% 4.950 3.465 N FLI1 n/a
10 TRCN0000005326 GCTGTTGTCACACCTCAGTTA pLKO.1 839 CDS 100% 4.950 3.465 N FLI1 n/a
11 TRCN0000005325 CCCTTCTGACATCTCCTACAT pLKO.1 1424 CDS 100% 4.950 2.970 N FLI1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017406.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00578 pDONR223 100% 92.6% 92.6% None 0_1ins99 n/a
2 ccsbBroad304_00578 pLX_304 0% 92.6% 92.6% V5 0_1ins99 n/a
Download CSV