Transcript: Human XM_017017498.2

PREDICTED: Homo sapiens zinc finger DHHC-type containing 5 (ZDHHC5), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZDHHC5 (25921)
Length:
4400
CDS:
1403..3244

Additional Resources:

NCBI RefSeq record:
XM_017017498.2
NBCI Gene record:
ZDHHC5 (25921)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000165572 GCCCACATTATGGGTGTGTTT pLKO.1 1568 CDS 100% 4.950 6.930 N ZDHHC5 n/a
2 TRCN0000162357 CCCAGTTACTAACTACGGAAA pLKO.1 3798 3UTR 100% 4.050 5.670 N ZDHHC5 n/a
3 TRCN0000125848 CGCACAACCAATGAACAGGTT pLKO.1 1739 CDS 100% 2.640 2.112 N Zdhhc5 n/a
4 TRCN0000166569 CGCACAACCAATGAACAGGTT pLKO.1 1739 CDS 100% 2.640 2.112 N ZDHHC5 n/a
5 TRCN0000280952 CGCACAACCAATGAACAGGTT pLKO_005 1739 CDS 100% 2.640 2.112 N ZDHHC5 n/a
6 TRCN0000162147 CGCAATGGAAGCCTATCTTAT pLKO.1 2486 CDS 100% 13.200 9.240 N ZDHHC5 n/a
7 TRCN0000280953 CGCAATGGAAGCCTATCTTAT pLKO_005 2486 CDS 100% 13.200 9.240 N ZDHHC5 n/a
8 TRCN0000313387 CTGGAGGGAACCAGATCATTT pLKO_005 3523 3UTR 100% 13.200 9.240 N Zdhhc5 n/a
9 TRCN0000160067 CCAGTTACTAACTACGGAAAT pLKO.1 3799 3UTR 100% 10.800 7.560 N ZDHHC5 n/a
10 TRCN0000165845 GCCAGGAGAGAAGAATCCAAA pLKO.1 4130 3UTR 100% 4.950 3.465 N ZDHHC5 n/a
11 TRCN0000165474 GCCATTACTGACACCCAAAGA pLKO.1 3061 CDS 100% 4.950 3.465 N ZDHHC5 n/a
12 TRCN0000280888 GCCATTACTGACACCCAAAGA pLKO_005 3061 CDS 100% 4.950 3.465 N ZDHHC5 n/a
13 TRCN0000165696 CAGCCATTACTGACACCCAAA pLKO.1 3059 CDS 100% 4.050 2.835 N ZDHHC5 n/a
14 TRCN0000164798 CGATGTCTTACAGCAGCCAAA pLKO.1 2997 CDS 100% 4.050 2.835 N ZDHHC5 n/a
15 TRCN0000280886 CGATGTCTTACAGCAGCCAAA pLKO_005 2997 CDS 100% 4.050 2.835 N ZDHHC5 n/a
16 TRCN0000160468 CCTCAGATGATTCAAAGAGAT pLKO.1 2853 CDS 100% 4.950 2.970 N ZDHHC5 n/a
17 TRCN0000280954 CCTCAGATGATTCAAAGAGAT pLKO_005 2853 CDS 100% 4.950 2.970 N ZDHHC5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017498.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11784 pDONR223 100% 92.4% 92.5% None 0_1ins147;688T>C;1194C>T n/a
2 ccsbBroad304_11784 pLX_304 0% 92.4% 92.5% V5 0_1ins147;688T>C;1194C>T n/a
3 TRCN0000477510 CATACTAGCGTTCCGTACCCAAAG pLX_317 19.8% 92.4% 92.5% V5 0_1ins147;688T>C;1194C>T n/a
Download CSV