Transcript: Human XM_017017706.1

PREDICTED: Homo sapiens speedy/RINGO cell cycle regulator family member C (SPDYC), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SPDYC (387778)
Length:
1893
CDS:
452..1444

Additional Resources:

NCBI RefSeq record:
XM_017017706.1
NBCI Gene record:
SPDYC (387778)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000430655 CTGCACCAGAGGGATAAGCTT pLKO_005 839 CDS 100% 3.000 4.200 N SPDYC n/a
2 TRCN0000220000 ACCTGAAGCTCAGCGAGTATA pLKO.1 693 CDS 100% 13.200 9.240 N SPDYC n/a
3 TRCN0000166976 CCAGATTTCAGATAAGTATCT pLKO.1 637 CDS 100% 4.950 3.465 N SPDYC n/a
4 TRCN0000167959 CCTGCTTCCAGATTTCAGATA pLKO.1 630 CDS 100% 4.950 3.465 N SPDYC n/a
5 TRCN0000446005 TCTGACCTCTGAATGTCATCG pLKO_005 1111 CDS 100% 4.050 2.835 N SPDYC n/a
6 TRCN0000444528 AGATTGGTGTTTACGAGTGGG pLKO_005 811 CDS 100% 2.160 1.512 N SPDYC n/a
7 TRCN0000220001 CTGCAGCAGCCACTTGCTTAA pLKO.1 1066 CDS 100% 10.800 6.480 N SPDYC n/a
8 TRCN0000166950 GATTTCAGATAAGTATCTCCT pLKO.1 640 CDS 100% 2.640 1.584 N SPDYC n/a
9 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 1857 3UTR 100% 4.950 2.475 Y CFLAR n/a
10 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 1857 3UTR 100% 4.950 2.475 Y C19orf31 n/a
11 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 1855 3UTR 100% 4.950 2.475 Y ERN2 n/a
12 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 1855 3UTR 100% 4.950 2.475 Y P3H4 n/a
13 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 1855 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017706.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05568 pDONR223 100% 78.5% 78.2% None 0_1ins57;791_958del n/a
2 ccsbBroad304_05568 pLX_304 0% 78.5% 78.2% V5 0_1ins57;791_958del n/a
Download CSV