Transcript: Human XM_017017896.1

PREDICTED: Homo sapiens PHD finger protein 21A (PHF21A), transcript variant X28, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PHF21A (51317)
Length:
3708
CDS:
506..2428

Additional Resources:

NCBI RefSeq record:
XM_017017896.1
NBCI Gene record:
PHF21A (51317)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000312642 ACGGAAGAACCTGATAGTAAA pLKO_005 700 CDS 100% 13.200 18.480 N PHF21A n/a
2 TRCN0000037001 CCAGAGACCTACCATTGCTAT pLKO.1 976 CDS 100% 4.950 6.930 N PHF21A n/a
3 TRCN0000327709 CCAGAGACCTACCATTGCTAT pLKO_005 976 CDS 100% 4.950 6.930 N PHF21A n/a
4 TRCN0000124326 GCCCATCAAAGTACCACAGTT pLKO.1 1159 CDS 100% 4.950 6.930 N Phf21a n/a
5 TRCN0000037000 CCCATCAAAGTACCACAGTTT pLKO.1 1160 CDS 100% 4.950 3.960 N PHF21A n/a
6 TRCN0000327785 CCCATCAAAGTACCACAGTTT pLKO_005 1160 CDS 100% 4.950 3.960 N PHF21A n/a
7 TRCN0000312641 CTAAACTTTCGCTACTATAAA pLKO_005 2890 3UTR 100% 15.000 10.500 N PHF21A n/a
8 TRCN0000036999 GCCCAGAATAACATTCCTATT pLKO.1 1244 CDS 100% 10.800 7.560 N PHF21A n/a
9 TRCN0000327712 GCCCAGAATAACATTCCTATT pLKO_005 1244 CDS 100% 10.800 7.560 N PHF21A n/a
10 TRCN0000037002 CCTGGAACTTTAGCAATTGTT pLKO.1 2021 CDS 100% 5.625 3.938 N PHF21A n/a
11 TRCN0000037003 GCTCAGCAATTCCATAAGTAA pLKO.1 2152 CDS 100% 5.625 3.938 N PHF21A n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017896.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_03282 pDONR223 100% 91.6% 90.5% None (many diffs) n/a
2 ccsbBroad304_03282 pLX_304 0% 91.6% 90.5% V5 (many diffs) n/a
3 TRCN0000479630 TCAAGGCTACCTTCCTCGCATTGT pLX_317 18.5% 91.6% 90.5% V5 (many diffs) n/a
Download CSV