Transcript: Human XM_017017926.1

PREDICTED: Homo sapiens contactin 5 (CNTN5), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CNTN5 (53942)
Length:
6640
CDS:
673..3975

Additional Resources:

NCBI RefSeq record:
XM_017017926.1
NBCI Gene record:
CNTN5 (53942)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017017926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000418469 AGTAGGGTTGAGATGGTTAAT pLKO_005 1972 CDS 100% 13.200 18.480 N CNTN5 n/a
2 TRCN0000073399 CCACCAATGTAAGCGGAAGAA pLKO.1 3002 CDS 100% 4.950 6.930 N CNTN5 n/a
3 TRCN0000073402 CTGAAATTATAGCTTCGCTAT pLKO.1 2351 CDS 100% 4.050 5.670 N CNTN5 n/a
4 TRCN0000421335 TCATCTATAGCTGGGTATTTA pLKO_005 1349 CDS 100% 15.000 10.500 N CNTN5 n/a
5 TRCN0000073401 CCATGTGTCTTTCAGAGTATT pLKO.1 713 CDS 100% 13.200 9.240 N CNTN5 n/a
6 TRCN0000426712 GAAGTGAAAGTTGGCGTTTAT pLKO_005 3214 CDS 100% 13.200 9.240 N CNTN5 n/a
7 TRCN0000428860 ACTAGAGGGAATGAGTCTTTC pLKO_005 3454 CDS 100% 10.800 7.560 N CNTN5 n/a
8 TRCN0000429099 AGGATAGAACTTACTCCTAAA pLKO_005 2389 CDS 100% 10.800 7.560 N CNTN5 n/a
9 TRCN0000073398 CGGTGAATAGAGTGTAGTGTA pLKO.1 4022 3UTR 100% 4.950 3.465 N CNTN5 n/a
10 TRCN0000073400 GCTGAAATTATAGCTTCGCTA pLKO.1 2350 CDS 100% 2.640 1.848 N CNTN5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017017926.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12027 pDONR223 100% 56% 56% None 1_882del;2733_3300delinsA n/a
2 ccsbBroad304_12027 pLX_304 0% 56% 56% V5 1_882del;2733_3300delinsA n/a
3 TRCN0000477911 ACCGGAATCGACCATTCGATAGGA pLX_317 18.7% 56% 56% V5 1_882del;2733_3300delinsA n/a
Download CSV