Transcript: Human XM_017018013.1

PREDICTED: Homo sapiens chromosome 11 open reading frame 16 (C11orf16), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
C11orf16 (56673)
Length:
2386
CDS:
586..1989

Additional Resources:

NCBI RefSeq record:
XM_017018013.1
NBCI Gene record:
C11orf16 (56673)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018013.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000134150 CCACAGGTAACAGTCAAATAA pLKO.1 2099 3UTR 100% 15.000 21.000 N C11orf16 n/a
2 TRCN0000134210 CAGTCAAATAACCACCAGTAT pLKO.1 2109 3UTR 100% 4.950 6.930 N C11orf16 n/a
3 TRCN0000134209 CCAACATCTGCAAAGAAGAAA pLKO.1 1802 CDS 100% 5.625 3.938 N C11orf16 n/a
4 TRCN0000137080 CCCAGAGAGCATCAAAGGAAA pLKO.1 1136 CDS 100% 4.950 3.465 N C11orf16 n/a
5 TRCN0000136895 CTGGAATGGCAAAGCTGCTAA pLKO.1 1176 CDS 100% 4.950 3.465 N C11orf16 n/a
6 TRCN0000134065 GTTCATTTCTGGAATGGCAAA pLKO.1 1168 CDS 100% 4.050 2.430 N C11orf16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018013.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14219 pDONR223 100% 86% 85.4% None (many diffs) n/a
2 ccsbBroad304_14219 pLX_304 0% 86% 85.4% V5 (many diffs) n/a
3 TRCN0000474124 AAATAAAAGGAGTGAGGTTTGCCT pLX_317 34.4% 86% 85.4% V5 (many diffs) n/a
Download CSV