Transcript: Human XM_017018394.1

PREDICTED: Homo sapiens caspase 1 (CASP1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CASP1 (834)
Length:
1732
CDS:
402..1607

Additional Resources:

NCBI RefSeq record:
XM_017018394.1
NBCI Gene record:
CASP1 (834)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000003504 CACACGTCTTGCTCTCATTAT pLKO.1 875 CDS 100% 13.200 18.480 N CASP1 n/a
2 TRCN0000003503 CTACAACTCAATGCAATCTTT pLKO.1 1158 CDS 100% 5.625 3.938 N CASP1 n/a
3 TRCN0000003502 CCAGATATACTACAACTCAAT pLKO.1 1149 CDS 100% 4.950 3.465 N CASP1 n/a
4 TRCN0000010796 GAAGAGTTTGAGGATGATGCT pLKO.1 1323 CDS 100% 2.640 1.584 N CASP1 n/a
5 TRCN0000118459 GCTTTGATTGACTCCGTTATT pLKO.1 558 CDS 100% 13.200 6.600 Y CARD16 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018394.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_00220 pDONR223 100% 73.8% 73.8% None (many diffs) n/a
2 ccsbBroad304_00220 pLX_304 0% 73.8% 73.8% V5 (many diffs) n/a
3 TRCN0000474677 CCATTCATATTATTATAAGTATAA pLX_317 41.2% 73.8% 73.8% V5 (many diffs) n/a
Download CSV