Transcript: Human XM_017018439.1

PREDICTED: Homo sapiens protein tyrosine phosphatase non-receptor type 5 (PTPN5), transcript variant X6, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PTPN5 (84867)
Length:
2724
CDS:
350..2341

Additional Resources:

NCBI RefSeq record:
XM_017018439.1
NBCI Gene record:
PTPN5 (84867)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000356152 ACGAGAAATGCACCGAGTATT pLKO_005 1395 CDS 100% 13.200 18.480 N PTPN5 n/a
2 TRCN0000367557 CATGCGAGCAGTACCAGTTTG pLKO_005 1642 CDS 100% 10.800 15.120 N PTPN5 n/a
3 TRCN0000002667 GAACGAGAAATGCACCGAGTA pLKO.1 1393 CDS 100% 4.050 3.240 N PTPN5 n/a
4 TRCN0000010728 CCACGGCAGACAGAGACATTT pLKO.1 2635 3UTR 100% 13.200 9.240 N PTPN5 n/a
5 TRCN0000356120 TTAACGATGGTTCCATCAATA pLKO_005 1994 CDS 100% 13.200 9.240 N PTPN5 n/a
6 TRCN0000002666 AGTCATTCACACGGAGGATTA pLKO.1 1465 CDS 100% 10.800 7.560 N PTPN5 n/a
7 TRCN0000029907 CCTCTGAGTTCCTACATCAAT pLKO.1 1226 CDS 100% 5.625 3.938 N Ptpn5 n/a
8 TRCN0000002665 TCCTGTGTTTGATTGTGTGAT pLKO.1 823 CDS 100% 4.950 3.465 N PTPN5 n/a
9 TRCN0000002664 GCTGCGACTCATCTCCCTCAA pLKO.1 1489 CDS 100% 1.350 0.945 N PTPN5 n/a
10 TRCN0000029904 GCAGGCGGAATTCTTTGAAAT pLKO.1 1081 CDS 100% 0.000 0.000 N Ptpn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018439.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09229 pDONR223 100% 58.8% 54.2% None (many diffs) n/a
2 ccsbBroad304_09229 pLX_304 0% 58.8% 54.2% V5 (many diffs) n/a
3 TRCN0000472997 GCTATGGCGAGTGCACGTAGATGT pLX_317 20.6% 58.8% 54.2% V5 (many diffs) n/a
Download CSV