Transcript: Human XM_017018467.1

PREDICTED: Homo sapiens DIX domain containing 1 (DIXDC1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
DIXDC1 (85458)
Length:
5725
CDS:
129..2177

Additional Resources:

NCBI RefSeq record:
XM_017018467.1
NBCI Gene record:
DIXDC1 (85458)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431918 GCAAAGAGCGAGTCCATTATA pLKO_005 810 CDS 100% 15.000 21.000 N DIXDC1 n/a
2 TRCN0000134516 GAACTCAAGTAGGTAGTGAAT pLKO.1 1834 CDS 100% 4.950 6.930 N DIXDC1 n/a
3 TRCN0000425515 AGAGCTACTGAGGGCAAATAT pLKO_005 1295 CDS 100% 15.000 10.500 N DIXDC1 n/a
4 TRCN0000138927 GCAGGGATCATTCTGGGTAAA pLKO.1 3250 3UTR 100% 10.800 7.560 N DIXDC1 n/a
5 TRCN0000137219 GCTATTGATCGGGAAGGAAAT pLKO.1 2022 CDS 100% 10.800 7.560 N DIXDC1 n/a
6 TRCN0000137860 GAGCGAGAGCTAGAACACAAA pLKO.1 1500 CDS 100% 4.950 3.465 N DIXDC1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018467.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09267 pDONR223 100% 68.7% 68% None (many diffs) n/a
2 ccsbBroad304_09267 pLX_304 0% 68.7% 68% V5 (many diffs) n/a
3 TRCN0000480287 CACCAATGGAACCAATAGCGAGGA pLX_317 26.6% 68.7% 68% V5 (many diffs) n/a
Download CSV