Transcript: Human XM_017018587.1

PREDICTED: Homo sapiens Ras and Rab interactor 1 (RIN1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
RIN1 (9610)
Length:
2414
CDS:
33..2201

Additional Resources:

NCBI RefSeq record:
XM_017018587.1
NBCI Gene record:
RIN1 (9610)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000077884 CCACTGTATGACGTGCCCAAT pLKO.1 132 CDS 100% 4.050 5.670 N RIN1 n/a
2 TRCN0000289139 CCACTGTATGACGTGCCCAAT pLKO_005 132 CDS 100% 4.050 5.670 N RIN1 n/a
3 TRCN0000077883 GAGCCTGCTGAGAAATCCTTT pLKO.1 2242 3UTR 100% 4.950 3.465 N RIN1 n/a
4 TRCN0000289194 GAGCCTGCTGAGAAATCCTTT pLKO_005 2242 3UTR 100% 4.950 3.465 N RIN1 n/a
5 TRCN0000077885 CAGTCTGAGACAACTGCTGAA pLKO.1 2100 CDS 100% 4.050 2.835 N RIN1 n/a
6 TRCN0000289195 CAGTCTGAGACAACTGCTGAA pLKO_005 2100 CDS 100% 4.050 2.835 N RIN1 n/a
7 TRCN0000222712 GCGGAAATCTAACACCCGCCA pLKO.1 311 CDS 100% 0.180 0.126 N RIN1 n/a
8 TRCN0000289196 GCGGAAATCTAACACCCGCCA pLKO_005 311 CDS 100% 0.180 0.126 N RIN1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018587.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07449 pDONR223 100% 92.1% 92.2% None 1284_1285ins183;1764A>G;1929G>A n/a
2 ccsbBroad304_07449 pLX_304 0% 92.1% 92.2% V5 1284_1285ins183;1764A>G;1929G>A n/a
3 TRCN0000475141 ACAGTTGCACCGCTCGTCTATCGA pLX_317 4.4% 92.1% 92.2% V5 1284_1285ins183;1764A>G;1929G>A n/a
Download CSV