Transcript: Human XM_017018848.1

PREDICTED: Homo sapiens GLIPR1 like 2 (GLIPR1L2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
GLIPR1L2 (144321)
Length:
2599
CDS:
269..1072

Additional Resources:

NCBI RefSeq record:
XM_017018848.1
NBCI Gene record:
GLIPR1L2 (144321)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431952 TGACTTGGGATGTAGCTTTAT pLKO_005 270 CDS 100% 13.200 18.480 N Glipr1l2 n/a
2 TRCN0000149510 GTACAAATGGTCCATCCTAAA pLKO.1 353 CDS 100% 10.800 15.120 N GLIPR1L2 n/a
3 TRCN0000148409 CGTAGACTTTATCAACGAGTA pLKO.1 6 5UTR 100% 4.050 5.670 N GLIPR1L2 n/a
4 TRCN0000149781 GACCTTATGAACCAGGAATAT pLKO.1 639 CDS 100% 13.200 9.240 N GLIPR1L2 n/a
5 TRCN0000417212 ATGAATTTACTGCAAGTATTG pLKO_005 414 CDS 100% 10.800 7.560 N GLIPR1L2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018848.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04971 pDONR223 100% 47.4% 42% None (many diffs) n/a
2 ccsbBroad304_04971 pLX_304 0% 47.4% 42% V5 (many diffs) n/a
3 TRCN0000474378 ACTACAGCCTCAATACTTATCCAT pLX_317 73.4% 47.4% 42% V5 (many diffs) n/a
Download CSV