Transcript: Human XM_017018885.1

PREDICTED: Homo sapiens C-type lectin like 1 (CLECL1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLECL1 (160365)
Length:
815
CDS:
84..491

Additional Resources:

NCBI RefSeq record:
XM_017018885.1
NBCI Gene record:
CLECL1 (160365)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000435568 AGATGTAGTCTACGCTGACAT pLKO_005 158 CDS 100% 4.950 6.930 N CLECL1 n/a
2 TRCN0000156062 CCATAAATCATGTCCTGCCAA pLKO.1 254 CDS 100% 2.640 3.696 N CLECL1 n/a
3 TRCN0000150508 GTTACTGGATTGCTGAAACTA pLKO.1 301 CDS 100% 5.625 4.500 N CLECL1 n/a
4 TRCN0000157011 GCGTTTCCACTTCAGAGATCT pLKO.1 210 CDS 100% 4.950 3.960 N CLECL1 n/a
5 TRCN0000416878 CCCTTCAGTGGGACATCATTT pLKO_005 99 CDS 100% 13.200 9.240 N CLECL1 n/a
6 TRCN0000155983 CAAAGACTGGAAGGTGCATAA pLKO.1 272 CDS 100% 10.800 7.560 N CLECL1 n/a
7 TRCN0000157968 CTGGAAGGTGCATAAGGGAAA pLKO.1 278 CDS 100% 4.050 2.835 N CLECL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018885.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05106 pDONR223 100% 56.2% 55.4% None (many diffs) n/a
2 ccsbBroad304_05106 pLX_304 0% 56.2% 55.4% V5 (many diffs) n/a
3 TRCN0000478027 TGAACTGGTCTTCTTTCAAGGCGG pLX_317 87.5% 56.2% 55.4% V5 (many diffs) n/a
Download CSV