Transcript: Human XM_017018914.1

PREDICTED: Homo sapiens coiled-coil domain containing 60 (CCDC60), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC60 (160777)
Length:
1516
CDS:
60..1184

Additional Resources:

NCBI RefSeq record:
XM_017018914.1
NBCI Gene record:
CCDC60 (160777)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144922 GCCTATATCATGTTCCTGTAT pLKO.1 1227 3UTR 100% 4.950 6.930 N CCDC60 n/a
2 TRCN0000416524 CAAGAGTAATTCTGCTTATAA pLKO_005 524 CDS 100% 15.000 10.500 N CCDC60 n/a
3 TRCN0000431825 ACAAGTCCATGGGACAGAAAT pLKO_005 133 CDS 100% 13.200 9.240 N CCDC60 n/a
4 TRCN0000142894 CCACTGGTACTTTGATCTGTT pLKO.1 887 CDS 100% 4.950 3.465 N CCDC60 n/a
5 TRCN0000142250 GAGACTGACTTCCAGCAACAT pLKO.1 1323 3UTR 100% 4.950 3.465 N CCDC60 n/a
6 TRCN0000141834 GCATTTCATCACAGCGCCAAA pLKO.1 158 CDS 100% 4.050 2.835 N CCDC60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018914.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09733 pDONR223 100% 67.6% 66.7% None (many diffs) n/a
2 ccsbBroad304_09733 pLX_304 0% 67.6% 66.7% V5 (many diffs) n/a
3 TRCN0000466262 AGGCACCTAGTCAATTGGCTGAAC pLX_317 26.2% 67.6% 66.7% V5 (many diffs) n/a
Download CSV