Transcript: Human XM_017018916.1

PREDICTED: Homo sapiens coiled-coil domain containing 60 (CCDC60), transcript variant X7, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CCDC60 (160777)
Length:
1422
CDS:
110..1090

Additional Resources:

NCBI RefSeq record:
XM_017018916.1
NBCI Gene record:
CCDC60 (160777)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017018916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000144922 GCCTATATCATGTTCCTGTAT pLKO.1 1133 3UTR 100% 4.950 6.930 N CCDC60 n/a
2 TRCN0000416524 CAAGAGTAATTCTGCTTATAA pLKO_005 430 CDS 100% 15.000 10.500 N CCDC60 n/a
3 TRCN0000142894 CCACTGGTACTTTGATCTGTT pLKO.1 793 CDS 100% 4.950 3.465 N CCDC60 n/a
4 TRCN0000142250 GAGACTGACTTCCAGCAACAT pLKO.1 1229 3UTR 100% 4.950 3.465 N CCDC60 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017018916.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09733 pDONR223 100% 59.2% 59.2% None 0_1ins672;45C>A n/a
2 ccsbBroad304_09733 pLX_304 0% 59.2% 59.2% V5 0_1ins672;45C>A n/a
3 TRCN0000466262 AGGCACCTAGTCAATTGGCTGAAC pLX_317 26.2% 59.2% 59.2% V5 0_1ins672;45C>A n/a
Download CSV