Transcript: Human XM_017019039.2

PREDICTED: Homo sapiens F-box protein 21 (FBXO21), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
FBXO21 (23014)
Length:
4121
CDS:
115..1521

Additional Resources:

NCBI RefSeq record:
XM_017019039.2
NBCI Gene record:
FBXO21 (23014)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000034288 CGGCAACAGAAGATCTTAAAT pLKO.1 175 CDS 100% 15.000 21.000 N FBXO21 n/a
2 TRCN0000299823 CGGCAACAGAAGATCTTAAAT pLKO_005 175 CDS 100% 15.000 21.000 N FBXO21 n/a
3 TRCN0000034284 CGGGCTCATTATGAAGCATAA pLKO.1 1149 CDS 100% 10.800 7.560 N FBXO21 n/a
4 TRCN0000299757 CGGGCTCATTATGAAGCATAA pLKO_005 1149 CDS 100% 10.800 7.560 N FBXO21 n/a
5 TRCN0000034286 CCTGGACATCTTTGACTACAT pLKO.1 675 CDS 100% 4.950 3.465 N FBXO21 n/a
6 TRCN0000299755 CCTGGACATCTTTGACTACAT pLKO_005 675 CDS 100% 4.950 3.465 N FBXO21 n/a
7 TRCN0000191924 GCAGAATATTTACAGTGCAAA pLKO.1 1479 CDS 100% 4.950 3.465 N Fbxo21 n/a
8 TRCN0000034287 GCTGGATCTCTATCTGGCAAT pLKO.1 888 CDS 100% 4.050 2.835 N FBXO21 n/a
9 TRCN0000299754 GCTGGATCTCTATCTGGCAAT pLKO_005 888 CDS 100% 4.050 2.835 N FBXO21 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019039.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11659 pDONR223 100% 75.9% 75.9% None 0_1ins207;554_733del;1281A>G n/a
2 ccsbBroad304_11659 pLX_304 0% 75.9% 75.9% V5 0_1ins207;554_733del;1281A>G n/a
3 TRCN0000476386 TCAAGCAAACGCGAACTTATGCCG pLX_317 21.8% 75.9% 75.9% V5 0_1ins207;554_733del;1281A>G n/a
Download CSV