Transcript: Human XM_017019043.1

PREDICTED: Homo sapiens MON2 homolog, regulator of endosome-to-Golgi trafficking (MON2), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MON2 (23041)
Length:
11829
CDS:
682..5622

Additional Resources:

NCBI RefSeq record:
XM_017019043.1
NBCI Gene record:
MON2 (23041)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000339008 GATGTACTACATCGCTATATA pLKO_005 5317 CDS 100% 15.000 21.000 N MON2 n/a
2 TRCN0000134891 CGTGGAATCACAAGTATGATT pLKO.1 1954 CDS 100% 0.563 0.450 N MON2 n/a
3 TRCN0000351068 CGTGGAATCACAAGTATGATT pLKO_005 1954 CDS 100% 0.563 0.450 N MON2 n/a
4 TRCN0000134864 CAGCAGTGTAAGGCTTTAATA pLKO.1 5815 3UTR 100% 15.000 10.500 N MON2 n/a
5 TRCN0000133790 CCTGAGAATGTTGATGGAAAT pLKO.1 5449 CDS 100% 10.800 7.560 N MON2 n/a
6 TRCN0000136375 CCATATCTCCAGTTGGTGATT pLKO.1 5882 3UTR 100% 4.950 3.465 N MON2 n/a
7 TRCN0000339007 CCATATCTCCAGTTGGTGATT pLKO_005 5882 3UTR 100% 4.950 3.465 N MON2 n/a
8 TRCN0000134146 CCCATTATGCTCTTACTGTAT pLKO.1 2309 CDS 100% 4.950 3.465 N MON2 n/a
9 TRCN0000135688 CCGTTAAAGGAGATGTCCAAT pLKO.1 3070 CDS 100% 4.950 3.465 N MON2 n/a
10 TRCN0000338937 CCGTTAAAGGAGATGTCCAAT pLKO_005 3070 CDS 100% 4.950 3.465 N MON2 n/a
11 TRCN0000135116 CCTGAATGAACAGCAGTGTAA pLKO.1 5805 3UTR 100% 4.950 3.465 N MON2 n/a
12 TRCN0000134579 GAAAGCAGGAAGATAGTCTAA pLKO.1 5640 3UTR 100% 4.950 3.465 N MON2 n/a
13 TRCN0000134689 GCTCAATACATTCTCAGTCAT pLKO.1 5135 CDS 100% 4.950 3.465 N MON2 n/a
14 TRCN0000338938 GCTCAATACATTCTCAGTCAT pLKO_005 5135 CDS 100% 4.950 3.465 N MON2 n/a
15 TRCN0000135543 GTCTTCTGTGAGAAGGACATT pLKO.1 5682 3UTR 100% 4.950 2.970 N MON2 n/a
16 TRCN0000007228 CACCTGTAATCCCAGCACTTT pLKO.1 10663 3UTR 100% 4.950 2.475 Y CFLAR n/a
17 TRCN0000166635 CACCTGTAATCCCAGCACTTT pLKO.1 10663 3UTR 100% 4.950 2.475 Y C19orf31 n/a
18 TRCN0000021429 CACACCTGTAATCCCAGCATT pLKO.1 10661 3UTR 100% 4.950 2.475 Y ERN2 n/a
19 TRCN0000138998 CACACCTGTAATCCCAGCATT pLKO.1 10661 3UTR 100% 4.950 2.475 Y P3H4 n/a
20 TRCN0000344020 CACACCTGTAATCCCAGCATT pLKO_005 10661 3UTR 100% 4.950 2.475 Y P3H4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019043.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.