Transcript: Human XM_017019103.1

PREDICTED: Homo sapiens ATP binding cassette subfamily B member 9 (ABCB9), transcript variant X3, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCB9 (23457)
Length:
3591
CDS:
372..2672

Additional Resources:

NCBI RefSeq record:
XM_017019103.1
NBCI Gene record:
ABCB9 (23457)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000303627 TCCGCCACTTCAACATCTTTG pLKO_005 484 CDS 100% 10.800 15.120 N ABCB9 n/a
2 TRCN0000060196 CATCACGGATAACATCTCCTA pLKO.1 2156 CDS 100% 2.640 3.696 N ABCB9 n/a
3 TRCN0000303626 AGCTCATTTGCCGCAGGTATT pLKO_005 1086 CDS 100% 10.800 8.640 N ABCB9 n/a
4 TRCN0000303691 TGTTCGTGTGGACGTACATTT pLKO_005 727 CDS 100% 13.200 9.240 N ABCB9 n/a
5 TRCN0000303628 TCACCAAGATGTTCTAGAAAC pLKO_005 3035 3UTR 100% 10.800 7.560 N ABCB9 n/a
6 TRCN0000060193 CTCTCCAAAGAGGTCCAGAAT pLKO.1 1428 CDS 100% 4.950 3.465 N ABCB9 n/a
7 TRCN0000060194 GATGGCATCGTCATCCAGAAA pLKO.1 1011 CDS 100% 4.950 3.465 N ABCB9 n/a
8 TRCN0000299388 GATGGCATCGTCATCCAGAAA pLKO_005 1011 CDS 100% 4.950 3.465 N ABCB9 n/a
9 TRCN0000060195 CTGTGTCAACATCCTGGAGAA pLKO.1 2012 CDS 100% 4.050 2.430 N ABCB9 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019103.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11737 pDONR223 100% 77.2% 76.1% None (many diffs) n/a
2 ccsbBroad304_11737 pLX_304 0% 77.2% 76.1% V5 (many diffs) n/a
3 TRCN0000468050 TGATTGCTCCTTTTCCACACCAGA pLX_317 21.7% 77.2% 76.1% V5 (many diffs) n/a
Download CSV