Transcript: Human XM_017019331.1

PREDICTED: Homo sapiens activating transcription factor 1 (ATF1), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ATF1 (466)
Length:
2277
CDS:
55..894

Additional Resources:

NCBI RefSeq record:
XM_017019331.1
NBCI Gene record:
ATF1 (466)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000273888 AGTTCAGGGAGCTCACATTTC pLKO_005 135 CDS 100% 10.800 15.120 N ATF1 n/a
2 TRCN0000013567 AGGTACAACTATTCTTCAGTA pLKO.1 510 CDS 100% 4.950 3.960 N ATF1 n/a
3 TRCN0000239182 AGACATTAACCATGACAAATT pLKO_005 473 CDS 100% 13.200 9.240 N Atf1-ps n/a
4 TRCN0000013564 GCTCAACAGGTATCATCTTTA pLKO.1 163 CDS 100% 13.200 9.240 N ATF1 n/a
5 TRCN0000273890 GCATAGGCTCCTCACAGAAAG pLKO_005 218 CDS 100% 10.800 7.560 N ATF1 n/a
6 TRCN0000424083 GCATAGGCTCCTCACAGAAAG pLKO_005 218 CDS 100% 10.800 7.560 N Atf1 n/a
7 TRCN0000273833 TGAAGGATCTTTATTCCAATA pLKO_005 863 CDS 100% 10.800 7.560 N ATF1 n/a
8 TRCN0000013563 CCTACAGGTTTGCATTTGTTT pLKO.1 1238 3UTR 100% 5.625 3.938 N ATF1 n/a
9 TRCN0000273834 CCTACAGGTTTGCATTTGTTT pLKO_005 1238 3UTR 100% 5.625 3.938 N ATF1 n/a
10 TRCN0000013566 CCCAGCAATCAGGTGGTCGTA pLKO.1 565 CDS 100% 0.880 0.616 N ATF1 n/a
11 TRCN0000013565 CAGCTACTTCTCTGCCACAAA pLKO.1 635 CDS 100% 4.950 2.970 N ATF1 n/a
12 TRCN0000273889 CAGCTACTTCTCTGCCACAAA pLKO_005 635 CDS 100% 4.950 2.970 N ATF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019331.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05862 pDONR223 100% 96.8% 96.7% None 1_24del;29A>N;351C>T n/a
2 ccsbBroad304_05862 pLX_304 0% 96.8% 96.7% V5 1_24del;29A>N;351C>T n/a
3 TRCN0000473362 TATATTACTACTTTTGGAAGTGGC pLX_317 30.7% 96.8% 96.7% V5 1_24del;29A>N;351C>T n/a
Download CSV