Transcript: Human XM_017019500.1

PREDICTED: Homo sapiens pleckstrin homology domain containing A5 (PLEKHA5), transcript variant X15, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PLEKHA5 (54477)
Length:
2450
CDS:
69..2126

Additional Resources:

NCBI RefSeq record:
XM_017019500.1
NBCI Gene record:
PLEKHA5 (54477)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000271423 CAACCATAGAGTGCTAATTAA pLKO_005 950 CDS 100% 15.000 10.500 N PLEKHA5 n/a
2 TRCN0000271366 CAGTTGGAACAGTGGATTAAA pLKO_005 1305 CDS 100% 15.000 10.500 N PLEKHA5 n/a
3 TRCN0000033846 CGGCCAATAAGTATGATAAAT pLKO.1 417 CDS 100% 15.000 10.500 N PLEKHA5 n/a
4 TRCN0000271365 CCCGCTACCCTGAAGGTTATA pLKO_005 1423 CDS 100% 13.200 9.240 N PLEKHA5 n/a
5 TRCN0000033845 GCACCAACTAAAGAAACCAAT pLKO.1 921 CDS 100% 4.950 3.465 N PLEKHA5 n/a
6 TRCN0000033847 GCCTGACTTTACAGTCTGTTA pLKO.1 1867 CDS 100% 4.950 3.465 N PLEKHA5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019500.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12044 pDONR223 100% 37.6% 34.8% None (many diffs) n/a
2 ccsbBroad304_12044 pLX_304 0% 37.6% 34.8% V5 (many diffs) n/a
Download CSV