Transcript: Human XM_017019539.1

PREDICTED: Homo sapiens PARP1 binding protein (PARPBP), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PARPBP (55010)
Length:
2491
CDS:
120..1262

Additional Resources:

NCBI RefSeq record:
XM_017019539.1
NBCI Gene record:
PARPBP (55010)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000431988 CTCCTCCCATTGGCAATTAAA pLKO_005 1559 3UTR 100% 15.000 21.000 N PARPBP n/a
2 TRCN0000432818 AGTAAATACAACCGTGATAAT pLKO_005 354 CDS 100% 13.200 18.480 N PARPBP n/a
3 TRCN0000167915 CCATTCACCAAAGACATGCTT pLKO.1 1302 3UTR 100% 3.000 2.400 N PARPBP n/a
4 TRCN0000434481 GACCTTTCTGAGGGTGTAAAT pLKO_005 912 CDS 100% 13.200 9.240 N PARPBP n/a
5 TRCN0000167104 CAAACTAGCTAAAGTAGCAAA pLKO.1 1169 CDS 100% 4.950 3.465 N PARPBP n/a
6 TRCN0000168712 GAGGGTGTAAATCCATCTGTT pLKO.1 921 CDS 100% 4.950 3.465 N PARPBP n/a
7 TRCN0000149356 GCCTGTGTTCTGTAAAGAGAA pLKO.1 2134 3UTR 100% 4.950 2.475 Y PMCHL2 n/a
8 TRCN0000153159 GCCTGTGTTCTGTAAAGAGAA pLKO.1 2134 3UTR 100% 4.950 2.475 Y PMCHL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019539.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12133 pDONR223 100% 66.4% 48.6% None (many diffs) n/a
2 ccsbBroad304_12133 pLX_304 0% 66.4% 48.6% V5 (many diffs) n/a
3 TRCN0000480593 CCAACCCAGCCGAAGGGAAAAAAG pLX_317 37.4% 66.4% 48.6% V5 (many diffs) n/a
Download CSV