Transcript: Human XM_017019545.1

PREDICTED: Homo sapiens TAP binding protein like (TAPBPL), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TAPBPL (55080)
Length:
1952
CDS:
777..1793

Additional Resources:

NCBI RefSeq record:
XM_017019545.1
NBCI Gene record:
TAPBPL (55080)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000060730 CCCAAGATGACCCACCTATTA pLKO.1 646 5UTR 100% 13.200 18.480 N TAPBPL n/a
2 TRCN0000419736 CGACATGAGACTACTAGAAAG pLKO_005 1801 3UTR 100% 10.800 15.120 N TAPBPL n/a
3 TRCN0000432611 CAGCCTTGGGAGTCATCTTTG pLKO_005 1603 CDS 100% 10.800 8.640 N TAPBPL n/a
4 TRCN0000435340 GGTGATGACACAGACCCAATC pLKO_005 962 CDS 100% 6.000 4.200 N TAPBPL n/a
5 TRCN0000434785 GTACGACTGAGCTTGGCAAAC pLKO_005 1302 CDS 100% 6.000 4.200 N TAPBPL n/a
6 TRCN0000060732 CTTCCTTCTTGCACTGATGTT pLKO.1 1634 CDS 100% 4.950 3.465 N TAPBPL n/a
7 TRCN0000060728 CCACTGTTAAGACAGCAGCTT pLKO.1 787 CDS 100% 2.640 1.848 N TAPBPL n/a
8 TRCN0000060729 GCTGGCTATTACCCTCTGGAT pLKO.1 1356 CDS 100% 2.640 1.848 N TAPBPL n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019545.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_14185 pDONR223 99.2% 71.8% 71.3% None (many diffs) n/a
2 ccsbBroad304_14185 pLX_304 0% 71.8% 71.3% V5 (not translated due to frame shift) (many diffs) n/a
3 TRCN0000469500 CGCCCGTTATACCAGGTGCGATGT pLX_317 24.6% 71.8% 71.3% V5 (not translated due to prior stop codon) (many diffs) n/a
4 TRCN0000479611 CTTGTATGTGCCGAACTACTTACA pLX_317 24.6% 71.8% 71.3% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV