Transcript: Human XM_017019644.1

PREDICTED: Homo sapiens protein arginine methyltransferase 8 (PRMT8), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PRMT8 (56341)
Length:
2329
CDS:
429..1538

Additional Resources:

NCBI RefSeq record:
XM_017019644.1
NBCI Gene record:
PRMT8 (56341)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000358773 GGACAACATCATCACCATATT pLKO_005 827 CDS 100% 13.200 18.480 N PRMT8 n/a
2 TRCN0000034749 GCTATCGTTCACATCTGCATT pLKO.1 1214 CDS 100% 4.950 6.930 N PRMT8 n/a
3 TRCN0000034750 GCTTTGTACGTGGTAGCGATT pLKO.1 1011 CDS 100% 4.050 5.670 N PRMT8 n/a
4 TRCN0000034752 CGTCTTCTACTTGGAAGATTA pLKO.1 1367 CDS 100% 1.320 1.056 N PRMT8 n/a
5 TRCN0000034753 GACAACATCATCACCATATTT pLKO.1 828 CDS 100% 15.000 10.500 N PRMT8 n/a
6 TRCN0000358704 ACTACTCAGAGAAGATCATTA pLKO_005 793 CDS 100% 13.200 9.240 N PRMT8 n/a
7 TRCN0000358706 TGTGAGCAGCATAGTTGATAT pLKO_005 1993 3UTR 100% 13.200 9.240 N PRMT8 n/a
8 TRCN0000358705 ATAGCATCTTTGATAGCATAA pLKO_005 1923 3UTR 100% 10.800 7.560 N PRMT8 n/a
9 TRCN0000097481 GAGGAAATCTACGGGACCATA pLKO.1 1407 CDS 100% 4.950 3.465 N Prmt8 n/a
10 TRCN0000034751 GATTATTACTTCGACTCCTAT pLKO.1 648 CDS 100% 4.950 3.465 N PRMT8 n/a
11 TRCN0000097482 GATTTCACAGTAGACTTGGAT pLKO.1 1464 CDS 100% 3.000 2.100 N Prmt8 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019644.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12303 pDONR223 100% 78.2% 78.1% None (many diffs) n/a
2 ccsbBroad304_12303 pLX_304 0% 78.2% 78.1% V5 (many diffs) n/a
3 TRCN0000473165 GGCGTTGGAGAATCTAACCAGGCG pLX_317 43.9% 78.2% 78.1% V5 (many diffs) n/a
Download CSV