Transcript: Human XM_017019767.1

PREDICTED: Homo sapiens PZP alpha-2-macroglobulin like (PZP), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PZP (5858)
Length:
3065
CDS:
29..2848

Additional Resources:

NCBI RefSeq record:
XM_017019767.1
NBCI Gene record:
PZP (5858)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000073645 CGCCCTCGAAATGAACTGATT pLKO.1 491 CDS 100% 4.950 6.930 N PZP n/a
2 TRCN0000073643 CGGCACACTATACACTGAATA pLKO.1 1446 CDS 100% 13.200 10.560 N PZP n/a
3 TRCN0000073646 CCATCTATGTTCCCTTATCAA pLKO.1 1977 CDS 100% 5.625 3.938 N PZP n/a
4 TRCN0000073644 CCCAAGTTTGAGGTCAAAGTT pLKO.1 704 CDS 100% 5.625 3.938 N PZP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019767.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11082 pDONR223 100% 54.1% 47.9% None (many diffs) n/a
2 ccsbBroad304_11082 pLX_304 0% 54.1% 47.9% V5 (many diffs) n/a
3 TRCN0000466926 TACCTCGCCGGTTGCGTTCGGTTC pLX_317 11% 54.1% 47.9% V5 (many diffs) n/a
Download CSV