Transcript: Human XM_017019819.1

PREDICTED: Homo sapiens SDS3 homolog, SIN3A corepressor complex component (SUDS3), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
SUDS3 (64426)
Length:
4815
CDS:
447..1220

Additional Resources:

NCBI RefSeq record:
XM_017019819.1
NBCI Gene record:
SUDS3 (64426)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000234396 GCGTCCTCACAACTCTTAATT pLKO_005 3319 3UTR 100% 15.000 21.000 N SUDS3 n/a
2 TRCN0000038911 AGGATCTACCTGGGCCAGCTT pLKO.1 1158 CDS 100% 0.880 1.232 N SUDS3 n/a
3 TRCN0000038910 GCTCGGATAGAAGATGGCAAA pLKO.1 996 CDS 100% 4.050 3.240 N SUDS3 n/a
4 TRCN0000218676 GGAGGATCTGAGAACATTAAA pLKO_005 884 CDS 100% 15.000 10.500 N SUDS3 n/a
5 TRCN0000234394 TGAACAAGTGGAACGAAATTA pLKO_005 596 CDS 100% 15.000 10.500 N SUDS3 n/a
6 TRCN0000218456 CAACTGCAAGAAGGTACATTA pLKO_005 489 CDS 100% 13.200 9.240 N SUDS3 n/a
7 TRCN0000038909 GCCCAGCTAAACTATTTGTTA pLKO.1 846 CDS 100% 5.625 3.938 N SUDS3 n/a
8 TRCN0000038912 AGGTGAAACCTATCATGACCA pLKO.1 760 CDS 100% 2.640 1.848 N SUDS3 n/a
9 TRCN0000038913 CCGCGGAATCTCCAGCCCAGA pLKO.1 967 CDS 100% 0.000 0.000 N SUDS3 n/a
10 TRCN0000234395 ACAAGAGCCAGGCCATCTATC pLKO_005 1042 CDS 100% 10.800 6.480 N SUDS3 n/a
11 TRCN0000106387 GTTGAGCTGAAAGAGAACCTT pLKO.1 663 CDS 100% 3.000 2.100 N Lcn5 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019819.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_12472 pDONR223 100% 65.7% 65.7% None 1_264del n/a
2 ccsbBroad304_12472 pLX_304 0% 65.7% 65.7% V5 1_264del n/a
3 TRCN0000481353 CACAAACGCGCGGACCTATCTCGA pLX_317 85% 65.7% 65.7% V5 1_264del n/a
Download CSV