Transcript: Human XM_017019970.1

PREDICTED: Homo sapiens VPS37B subunit of ESCRT-I (VPS37B), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
VPS37B (79720)
Length:
612
CDS:
72..566

Additional Resources:

NCBI RefSeq record:
XM_017019970.1
NBCI Gene record:
VPS37B (79720)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017019970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000122091 CAGAATGTTCAGCTTAACAAA pLKO.1 363 CDS 100% 5.625 3.938 N VPS37B n/a
2 TRCN0000140578 GAGACCCTGTTAGCACTTCTT pLKO.1 554 CDS 100% 4.950 3.465 N VPS37B n/a
3 TRCN0000139237 CCAGGTTCTCTTTGAAGCCTA pLKO.1 488 CDS 100% 2.640 1.848 N VPS37B n/a
4 TRCN0000145312 CCTATCAGATAAAGAAGACCA pLKO.1 505 CDS 100% 2.640 1.848 N VPS37B n/a
5 TRCN0000141850 GATTGAGGAAGACACTGAGAA pLKO.1 592 3UTR 100% 4.950 3.465 N VPS37B n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017019970.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_04113 pDONR223 100% 30.5% 28.4% None 111_287del;458_459insAGAC;492_493ins536 n/a
2 ccsbBroad304_04113 pLX_304 0% 30.5% 28.4% V5 111_287del;458_459insAGAC;492_493ins536 n/a
3 TRCN0000467771 ATTGCGTGCCCTTACATCGGAGCG pLX_317 2.1% 30.5% 28.4% V5 111_287del;458_459insAGAC;492_493ins536 n/a
Download CSV