Transcript: Human XM_017020229.1

PREDICTED: Homo sapiens piwi like RNA-mediated gene silencing 1 (PIWIL1), transcript variant X5, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
PIWIL1 (9271)
Length:
2723
CDS:
180..2678

Additional Resources:

NCBI RefSeq record:
XM_017020229.1
NBCI Gene record:
PIWIL1 (9271)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000417558 ACCCTAGACTAACGGTAATTG pLKO_005 2374 CDS 100% 13.200 18.480 N PIWIL1 n/a
2 TRCN0000417262 GTGAGGATAACGATCACTTTA pLKO_005 750 CDS 100% 13.200 18.480 N PIWIL1 n/a
3 TRCN0000007877 CCAGTCAGCAACCTGGTTATA pLKO.1 256 CDS 100% 13.200 9.240 N PIWIL1 n/a
4 TRCN0000007879 CGACTCATTGATTACATTCAT pLKO.1 1446 CDS 100% 5.625 3.938 N PIWIL1 n/a
5 TRCN0000007878 GCCTTATATCAGTATCACATT pLKO.1 561 CDS 100% 4.950 3.465 N PIWIL1 n/a
6 TRCN0000007880 GCTGTGAGAAGTGGTAGTGTT pLKO.1 2526 CDS 100% 4.950 3.465 N PIWIL1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020229.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07384 pDONR223 100% 96.3% 95.3% None (many diffs) n/a
2 ccsbBroad304_07384 pLX_304 0% 96.3% 95.3% V5 (many diffs) n/a
3 TRCN0000478305 CGCGCGAGCACGAGATCGCAAACA pLX_317 12.3% 96.3% 95.3% V5 (many diffs) n/a
Download CSV