Transcript: Human XM_017020321.1

PREDICTED: Homo sapiens ATP binding cassette subfamily C member 4 (ABCC4), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ABCC4 (10257)
Length:
5365
CDS:
1163..3625

Additional Resources:

NCBI RefSeq record:
XM_017020321.1
NBCI Gene record:
ABCC4 (10257)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000005268 GCCTTACAAGAGGTACAACTT pLKO.1 3092 CDS 100% 4.950 6.930 N ABCC4 n/a
2 TRCN0000279929 GCCTTACAAGAGGTACAACTT pLKO_005 3092 CDS 100% 4.950 6.930 N ABCC4 n/a
3 TRCN0000005264 CCACCAGTTAAATGCCGTCTA pLKO.1 3856 3UTR 100% 4.050 5.670 N ABCC4 n/a
4 TRCN0000279930 CCACCAGTTAAATGCCGTCTA pLKO_005 3856 3UTR 100% 4.050 5.670 N ABCC4 n/a
5 TRCN0000279932 GAAATTGGACTTCACGATTTA pLKO_005 2966 CDS 100% 13.200 9.240 N ABCC4 n/a
6 TRCN0000005266 GCACTCATTAAATCACAAGAA pLKO.1 2834 CDS 100% 4.950 3.465 N ABCC4 n/a
7 TRCN0000005267 GCTCCGGTATTATTCTTTGAT pLKO.1 2069 CDS 100% 5.625 3.375 N ABCC4 n/a
8 TRCN0000279928 GCTCCGGTATTATTCTTTGAT pLKO_005 2069 CDS 100% 5.625 3.375 N ABCC4 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020321.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 TRCN0000488469 GAGGGTGCTGTAACAACCAGAGTC pLX_317 7.1% 61.4% 60.9% V5 (not translated due to prior stop codon) (many diffs) n/a
Download CSV