Transcript: Human XM_017020393.2

PREDICTED: Homo sapiens carboxypeptidase B2 (CPB2), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CPB2 (1361)
Length:
1830
CDS:
38..1282

Additional Resources:

NCBI RefSeq record:
XM_017020393.2
NBCI Gene record:
CPB2 (1361)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000371837 ATGGGATAATAGGGCAATATA pLKO_005 615 CDS 100% 15.000 21.000 N CPB2 n/a
2 TRCN0000371838 TGTGGTTCATAGGCCATATAA pLKO_005 585 CDS 100% 15.000 21.000 N CPB2 n/a
3 TRCN0000371898 TATTCCTATACACGAAGTAAA pLKO_005 968 CDS 100% 13.200 18.480 N CPB2 n/a
4 TRCN0000046893 GAACCTAATAAGTGCTACTTT pLKO.1 1418 3UTR 100% 5.625 7.875 N CPB2 n/a
5 TRCN0000046894 CCGTTCTTTCTATGCGAACAA pLKO.1 733 CDS 100% 4.950 6.930 N CPB2 n/a
6 TRCN0000046896 GCATCCTGATATGCTTACAAA pLKO.1 427 CDS 100% 5.625 3.938 N CPB2 n/a
7 TRCN0000046895 GCTGACCTTATTGTGAAGAAA pLKO.1 185 CDS 100% 5.625 3.938 N CPB2 n/a
8 TRCN0000046897 CGCATCGTACTATGAACAGTA pLKO.1 358 CDS 100% 4.950 3.465 N CPB2 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020393.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_06027 pDONR223 100% 96% 94.7% None (many diffs) n/a
2 ccsbBroad304_06027 pLX_304 0% 96% 94.7% V5 (many diffs) n/a
3 TRCN0000466365 TCGCTTATATTCATGCGACGACGA pLX_317 29.6% 96% 94.7% V5 (many diffs) n/a
Download CSV