Transcript: Human XM_017020522.2

PREDICTED: Homo sapiens arachidonate 5-lipoxygenase activating protein (ALOX5AP), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ALOX5AP (241)
Length:
753
CDS:
68..433

Additional Resources:

NCBI RefSeq record:
XM_017020522.2
NBCI Gene record:
ALOX5AP (241)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000413713 ATGTCCGTTGCTGGCATATTC pLKO_005 320 CDS 100% 13.200 18.480 N ALOX5AP n/a
2 TRCN0000078151 CCCTGGCTACATATTTGGGAA pLKO.1 274 CDS 100% 2.640 2.112 N ALOX5AP n/a
3 TRCN0000078152 CTACATATTTGGGAAACGCAT pLKO.1 280 CDS 100% 2.640 2.112 N ALOX5AP n/a
4 TRCN0000427620 GGGCTTCACAGCTTGAGTTAA pLKO_005 551 3UTR 100% 13.200 9.240 N ALOX5AP n/a
5 TRCN0000433249 GGGTTGGTGTTCTCATCTAAT pLKO_005 450 3UTR 100% 13.200 9.240 N ALOX5AP n/a
6 TRCN0000078149 GCTGGACTGATGTACTTGTTT pLKO.1 203 CDS 100% 5.625 3.938 N ALOX5AP n/a
7 TRCN0000078148 GCTCTTCTTTAGATGGCTGTA pLKO.1 514 3UTR 100% 4.050 2.835 N ALOX5AP n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020522.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_05804 pDONR223 100% 71.8% 66.4% None (many diffs) n/a
2 ccsbBroad304_05804 pLX_304 0% 71.8% 66.4% V5 (many diffs) n/a
3 TRCN0000478230 ACCCGTTAACAAATATCATCATCT pLX_317 9.7% 71.8% 66.4% V5 (many diffs) n/a
Download CSV