Transcript: Human XM_017020546.1

PREDICTED: Homo sapiens neurobeachin (NBEA), transcript variant X8, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
NBEA (26960)
Length:
10471
CDS:
144..8726

Additional Resources:

NCBI RefSeq record:
XM_017020546.1
NBCI Gene record:
NBEA (26960)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000420452 GTTTCGTATGGATCCATTAAA pLKO_005 608 CDS 100% 15.000 21.000 N NBEA n/a
2 TRCN0000033604 GCCGACTCTTTGCAGTGAATA pLKO.1 7747 CDS 100% 13.200 10.560 N NBEA n/a
3 TRCN0000418854 TATTGCAGGACGGACATATAA pLKO_005 6737 CDS 100% 15.000 10.500 N NBEA n/a
4 TRCN0000423471 CCCAATAGTAGTACATCATTT pLKO_005 3240 CDS 100% 13.200 9.240 N NBEA n/a
5 TRCN0000033605 CGGACTACAATGTTTCGTATT pLKO.1 3795 CDS 100% 10.800 7.560 N NBEA n/a
6 TRCN0000033607 GCACGGAAGAAGATGTAGTAA pLKO.1 6127 CDS 100% 5.625 3.938 N NBEA n/a
7 TRCN0000033606 CGGTGTTATGTTAATGGACAA pLKO.1 849 CDS 100% 4.050 2.430 N NBEA n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020546.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

No results found.