Transcript: Human XM_017020801.1

PREDICTED: Homo sapiens mesenteric estrogen dependent adipogenesis (MEDAG), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
MEDAG (84935)
Length:
2775
CDS:
1175..1633

Additional Resources:

NCBI RefSeq record:
XM_017020801.1
NBCI Gene record:
MEDAG (84935)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020801.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000423620 AGAGACACCCAACCAATTTAT pLKO_005 1609 CDS 100% 15.000 21.000 N MEDAG n/a
2 TRCN0000416764 GACGTACGCGTTTCTTGTAAA pLKO_005 1114 5UTR 100% 13.200 18.480 N MEDAG n/a
3 TRCN0000418922 GCTCAGTAATTCCGTTGTAAA pLKO_005 1348 CDS 100% 13.200 18.480 N MEDAG n/a
4 TRCN0000128072 GCAGTTTCTCTGACCGAAAGT pLKO.1 1470 CDS 100% 4.950 6.930 N MEDAG n/a
5 TRCN0000128142 CTCAGTGATTGGAGAAAGTTA pLKO.1 1192 CDS 100% 5.625 3.938 N MEDAG n/a
6 TRCN0000129070 GCCATATGACACCTATGAGAA pLKO.1 2188 3UTR 100% 0.000 0.000 N MEDAG n/a
7 TRCN0000128656 CATTTCCAAGTGTTCTGGAAT pLKO.1 1584 CDS 100% 0.495 0.297 N MEDAG n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020801.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_09243 pDONR223 99.2% 50.1% 50.1% None 0_1ins453 n/a
2 ccsbBroad304_09243 pLX_304 0% 50.1% 50.1% V5 0_1ins453 n/a
3 TRCN0000492051 GACTTTTCTTACCTTTTACAGAAT pLX_317 47.3% 50.1% 50.1% V5 0_1ins453 n/a
Download CSV