Transcript: Human XM_017020802.1

PREDICTED: Homo sapiens TNF superfamily member 11 (TNFSF11), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
TNFSF11 (8600)
Length:
2005
CDS:
119..910

Additional Resources:

NCBI RefSeq record:
XM_017020802.1
NBCI Gene record:
TNFSF11 (8600)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000355653 CCGGATCAGGATGCAACATAC pLKO_005 857 CDS 100% 10.800 8.640 N TNFSF11 n/a
2 TRCN0000368358 CTAATGGTGTACGTCACTAAA pLKO_005 668 CDS 100% 13.200 9.240 N TNFSF11 n/a
3 TRCN0000003367 GCAGTATATTTCTTCGTTCTT pLKO.1 1599 3UTR 100% 4.950 3.465 N TNFSF11 n/a
4 TRCN0000003366 GTATCTTCAACTAATGGTGTA pLKO.1 658 CDS 100% 4.050 2.835 N TNFSF11 n/a
5 TRCN0000003363 CCCATAAAGTGAGTCTGTCCT pLKO.1 492 CDS 100% 2.640 1.848 N TNFSF11 n/a
6 TRCN0000003364 GCAGAGAAAGCGATGGTGGAT pLKO.1 380 CDS 100% 2.640 1.848 N TNFSF11 n/a
7 TRCN0000003365 AGAGGAAATCAGCATCGAGGT pLKO.1 814 CDS 100% 2.160 1.296 N TNFSF11 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020802.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07271 pDONR223 100% 78.4% 74.7% None (many diffs) n/a
2 ccsbBroad304_07271 pLX_304 0% 78.4% 74.7% V5 (many diffs) n/a
3 TRCN0000476809 TCCAACACAGCGAGCCTCTTGGCT pLX_317 38.6% 78.4% 74.7% V5 (many diffs) n/a
4 ccsbBroadEn_01964 pDONR223 100% 78.4% 74.7% None (many diffs) n/a
5 ccsbBroad304_01964 pLX_304 0% 78.4% 74.7% V5 (many diffs) n/a
6 TRCN0000471482 AAGAGGCTGCTTTAGCTACCCTTT pLX_317 45% 78.4% 74.7% V5 (many diffs) n/a
Download CSV