Transcript: Human XM_017020843.1

PREDICTED: Homo sapiens claudin 10 (CLDN10), transcript variant X1, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CLDN10 (9071)
Length:
1277
CDS:
247..1053

Additional Resources:

NCBI RefSeq record:
XM_017020843.1
NBCI Gene record:
CLDN10 (9071)

sgRNA constructs matching this transcript (CRISPRko, NGG PAM)

This list includes CRISPRko constructs with 100% (20mer + NGG) sequence match to the coding regions of this transcript.

No results found.

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000439099 CAAAGTCGGAGGCTCCGATAA pLKO_005 678 CDS 100% 10.800 15.120 N CLDN10 n/a
2 TRCN0000116566 CGCTCTTTGGAATGAAGTGTA pLKO.1 656 CDS 100% 4.950 6.930 N CLDN10 n/a
3 TRCN0000116564 CGGACAAAGTATCATGGTGGA pLKO.1 976 CDS 100% 2.160 3.024 N CLDN10 n/a
4 TRCN0000116565 CCTGGGCTTCTTTGGTTCCAT pLKO.1 630 CDS 100% 3.000 2.100 N CLDN10 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020843.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_02073 pDONR223 100% 73% 64.9% None (many diffs) n/a
2 ccsbBroad304_02073 pLX_304 0% 73% 64.9% V5 (many diffs) n/a
3 TRCN0000465260 CCGTCCAGCCGGTATACATTTAAA pLX_317 48.1% 73% 64.9% V5 (many diffs) n/a
Download CSV