Transcript: Human XM_017020932.1

PREDICTED: Homo sapiens cell growth regulator with ring finger domain 1 (CGRRF1), transcript variant X2, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
CGRRF1 (10668)
Length:
1974
CDS:
229..1047

Additional Resources:

NCBI RefSeq record:
XM_017020932.1
NBCI Gene record:
CGRRF1 (10668)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017020932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000293970 CAGTTACCAAGAGATACTAAA pLKO_005 505 CDS 100% 13.200 18.480 N CGRRF1 n/a
2 TRCN0000294040 AGTACACTTTCTACTAAAGAT pLKO_005 1067 3UTR 100% 5.625 7.875 N CGRRF1 n/a
3 TRCN0000033751 GCGCTATTGACCTTAGCTGAT pLKO.1 571 CDS 100% 4.050 5.670 N CGRRF1 n/a
4 TRCN0000298669 CTCTTGGCTCAAGGTCAATTT pLKO_005 694 CDS 100% 13.200 9.240 N CGRRF1 n/a
5 TRCN0000033753 CAGTGATTCATATTCCTGATA pLKO.1 632 CDS 100% 4.950 3.465 N CGRRF1 n/a
6 TRCN0000033750 GCAGGCAGTTTGTTCAGGAAT pLKO.1 971 CDS 100% 4.950 3.465 N CGRRF1 n/a
7 TRCN0000286649 GCAGGCAGTTTGTTCAGGAAT pLKO_005 971 CDS 100% 4.950 3.465 N CGRRF1 n/a
8 TRCN0000033752 GCATGTTTATTGCTTCAGAAT pLKO.1 387 CDS 100% 4.950 3.465 N CGRRF1 n/a
9 TRCN0000033749 GCATTAGAAGATGCTCTGTAT pLKO.1 421 CDS 100% 4.950 3.465 N CGRRF1 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017020932.1, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_07667 pDONR223 100% 81.8% 81.6% None 0_1ins180;128G>A n/a
2 ccsbBroad304_07667 pLX_304 0% 81.8% 81.6% V5 0_1ins180;128G>A n/a
3 TRCN0000472481 TATCATCGGATCTAACTATCCCCC pLX_317 42.2% 81.8% 81.6% V5 0_1ins180;128G>A n/a
Download CSV