Transcript: Human XM_017021127.2

PREDICTED: Homo sapiens zinc finger FYVE-type containing 26 (ZFYVE26), transcript variant X4, mRNA.

Source:
NCBI, updated 2019-09-08
Taxon:
Homo sapiens (human)
Gene:
ZFYVE26 (23503)
Length:
6082
CDS:
161..5473

Additional Resources:

NCBI RefSeq record:
XM_017021127.2
NBCI Gene record:
ZFYVE26 (23503)

shRNA constructs matching this transcript with 100% SDR[?] match

This list includes all shRNAs that have a perfect SDR[?] match to Human XM_017021127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon).

Clone ID Target Seq Vector Match Position Match Region[?] SDR Match %[?] Intrinsic Score[?] Adjusted Score[?] Matches Other Human Gene?[?] Orig. Target Gene[?] Addgene[?]
1 TRCN0000158370 CGGCGTTTGAATAGTAGCCTT pLKO.1 824 CDS 100% 2.640 3.696 N ZFYVE26 n/a
2 TRCN0000157120 GCCCAAGTAGAGCACAAGATT pLKO.1 476 CDS 100% 5.625 4.500 N ZFYVE26 n/a
3 TRCN0000338692 TGAAACTCTTCTCCATTTAAA pLKO_005 5801 3UTR 100% 15.000 10.500 N ZFYVE26 n/a
4 TRCN0000338759 AGGTTCGGGCCTACCTGATAT pLKO_005 5268 CDS 100% 13.200 9.240 N ZFYVE26 n/a
5 TRCN0000153278 GCCCAAGCATTTCTGAACAAA pLKO.1 5780 3UTR 100% 5.625 3.938 N ZFYVE26 n/a
6 TRCN0000152294 CAGTTTATGAAGGACCAAGTT pLKO.1 4628 CDS 100% 4.950 3.465 N ZFYVE26 n/a
7 TRCN0000154083 GCCAAGATGATGTTCGTCAAA pLKO.1 3809 CDS 100% 4.950 3.465 N ZFYVE26 n/a
8 TRCN0000157654 GTGGACGATTTGAGCAGCATA pLKO.1 2153 CDS 100% 4.950 3.465 N ZFYVE26 n/a
9 TRCN0000338756 GTGGACGATTTGAGCAGCATA pLKO_005 2153 CDS 100% 4.950 3.465 N ZFYVE26 n/a
10 TRCN0000158252 CGCCAAGATGATGTTCGTCAA pLKO.1 3808 CDS 100% 4.050 2.835 N ZFYVE26 n/a
11 TRCN0000338691 CGCCAAGATGATGTTCGTCAA pLKO_005 3808 CDS 100% 4.050 2.835 N ZFYVE26 n/a
Download CSV

shRNA constructs with at least a near match to this transcript

This list includes shRNAs that have at least a >84% (16 of 19 bases) SDR[?] match to the transcript XM_017021127.2, regardless of what transcript they were originally designed to target. For example, this list can include shRNAs that were originally designed to target: (i) a different isoform or obsolete version of this transcript (as annotated by NCBI), (ii) a transcript of an orthologous gene (in this collection, generally human-to-mouse or mouse-to-human), or (iii) a transcript of a different gene (from the same or different taxon). NOTE: this download is a superset of the above result set.

Download CSV

All ORF constructs matching this transcript

Clone ID DNA Barcode Vector Sequenced %[?] Nuc. Match %[?] Prot. Match %[?] Epitope Tag Match Diffs[?] Addgene[?]
1 ccsbBroadEn_11741 pDONR223 100% 18.3% 17.9% None (many diffs) n/a
2 ccsbBroad304_11741 pLX_304 0% 18.3% 17.9% V5 (many diffs) n/a
3 TRCN0000474249 TAGCTTTCTACTTACTCCCCACTC pLX_317 38.7% 18.3% 17.9% V5 (many diffs) n/a
Download CSV